Seniored A Bit Too Hard

The stereotype has officially achieved boss-level status. After 15 years in the industry, I've watched countless devs disappear into the coding void only to emerge with new GitHub profiles and anime avatars. The pipeline from "I'll just fix this one bug" to "3AM coding sessions fueled by energy drinks while questioning existence" is basically industry standard at this point. Your IDE becomes your personality and your commit history your social life. The real secret gender is clearly "programmer with 27 unfinished side projects."

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Content Micro SFF stories MicroSFF "I expected someone..." "Taller?" "Yes," the knight said, looking down at the dragon. "Dragons grow in proportion to their hoard." "I heard your hoard was huge, thousands and thousands of books." "It is." "But?" "I went digital," the dragon said, showing the SD card they lay on. 6:10 AM Aug 25, 2021 Hootsuite Inc. 101 Comments Award ( Share Save Hide I report Sort By: Best View all comments (6 BEEF WIENERS 2h A year later the knight returns and the dragon is massive now. "What happened!?" The dragon ushers the knight further into the cave where illumination comes from blinky lights. A bearded fellow in a plaid shirt and spectacles holds a clipboard, looking up from it only momentarily before returning to his task. The dragon grins, "This is Theo, he's taught me all about backups! And once I had a NAS, well, it all sort of spiraled out from there hardware-wise.' 20 60 Reply Give Award Share Report Save

Content Mehdi: What, you write some code and suddently you know electronics? YOU DON'T KNOW A DAMN THING! Me, a Computer Science student: Never before have I been so offended by something I one hundred percent agree with.

Content guess a number between one and three billion A number between -1,294,967,296 and 1? Let's see. Is the number -647,483,647? yes -647,483,647. I like that number. I'll see you the next time.

Content