If It Works, Don't Touch It

Content Now that the summer is over do you guys have any interesting intern stories (from either the intern perspective or vice versa? in CSCareerQuestions by blackjack95129 1 88 0 92 1d goingtocalifornia25 1 251 The other intern on my team had 1 commit for our project, I had 47. 22h Gyuudon 96 chadsexytime 57 HugeRichard11 50 ToastedFlapJacks 12 CE Student TuckFottenham 1 10 Intern, Amazon V PROchief 3 Ben1182367 238 22h For much of my time I was assigned no work, and then at the end of my employment I got berated by my boss for a good 15 minutes for not doing enough work. By then end of the summer I only had 1 commit on the whole project while my partner had like 50. Idk how he got so much to do.

The eternal emotional rollercoaster of indie game development. Left panel: "Oh look, someone's actually paying for my game that took 3 years to make!" Right panel: "...and they got it for $1 during a Steam sale, so I'll make approximately enough to buy half a cup of coffee." That feeling when your passion project becomes a financial rounding error. But hey, at least they didn't torrent it.

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Content Code that does 1000 things Code when it's updated to do 1001 things Prodrammersamorn

Content The Handover This is my code It's your problem now I'm out

Content REIKACANJA OTTER THIS WORLD THAT WAS EASY. I'M TELLING YOU, PROGRAMMING IS THE FUTURE! YOU SHOULD LEARN TO CODE. WRITING YOUR FIRST LINE OF CODE. print("Hello, world!") RUN CODE click buzz MEANWHILE buzz buzz: Messages 7,825 NEW Otter McOrterface Hello, world! Cailyn Jones Hello, world! Juniper Hooper Hello, world! Melanie Benbow Hello, world!