Keep Your API Secrets Then

api documentation Frustration Integration Reverse engineering Client

Backend Programming Debugging Testing

4 months ago 176,137 views 0 shares

Keep Your API Secrets Then

api-memes, documentation-memes, debugging-memes, backend-memes, programming-memes | ProgrammerHumor.io

THE ABSOLUTE DRAMA of trying to implement a client API that refuses to share its documentation! You're sitting there, practically BEGGING for a crumb of information, and the API is just standing there like "All right then. Keep your secrets." The sheer AUDACITY! You're expected to somehow connect to this mysterious black box while the documentation is locked away in some digital vault guarded by dragons or something. Fine! I'll just reverse engineer your entire system through trial, error, and seventeen mental breakdowns. WHO NEEDS SLEEP ANYWAY?!

More Like This

Elon's Flawless Twitter Profit Strategy

Backend Webdev Devops Javascript Programming

6 months ago 173.2K views 0 shares

Elon's Flawless Twitter Profit Strategy

Elon's master plan for Twitter profitability is peak corporate strategy: Step 1: Make Twitter profitable (revolutionary concept) Step 2: Fire developers to cut costs (because who needs those pesky people who make things work?) Step 3: Introduce paid API plans (monetize everything!) Step 4: Completely forget to create your own subscription to said API (minor oversight) Nothing says "flawless execution" like charging for something you yourself can't figure out how to use. Classic billionaire move - break the stairs while climbing them.

On god

Backend

2 years ago 7.0K views 0 shares

On god | code-memes, c-memes, IT-memes | ProgrammerHumor.io

Content T 00 Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human7605232288.eke Eile Edit Help made he mouth way too big lmao rim leavin it in LOL CGTAGCTAGTCATGCAGATGOTATGGICCITA GAAATCGCCGTTGGGCAGAAATTTATCCGGAG this guy is gonna be so DUMB GTTACGCTTGATGATATGGTGGAGTGCCGT GAATCGCCGAAGTAGCGITGGGICGGATCGAT AAGTCCTAGTGCGTATACAGGTITCCCGCGTA im just put some baboon code in here n see what happens CGAGTGCTGATCGTGGGTAATTGGTCGGTCAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGGTGAGCGAGTIGCGATICGIGA GGIGGAGTCGAGIGGGIGAGCGTAGGCGTAGC X

Every Problem Ihave Python Has Abulit In Function For It

Backend Python

1 year ago 27.3K views 0 shares

everyProblemIHavePythonHasABulitInFunctionForIt | python-memes, function-memes | ProgrammerHumor.io

Content Me having no idea how to fix an obscure problem in Python Some random-ass code word designed specifically to solve my made with mematic problem. ProdrammerHumor.io

I Prefer Death To Doing Screen In Java

Backend Java Frontend

1 year ago 40.9K views 1 shares

iPreferDeathToDoingScreenInJava | computer-memes, java-memes, computer science-memes, front-end-memes | ProgrammerHumor.io

Content g1 TRANSLATED NOTICIAS DE TI Q CO-WORKERS GET INTO A KNIFE FIGHT AFTER ONE OF THEM SUGGESTED JAVA ON THE FRONT-END THE 21-YEAR-OLD COMPUTER SCIENCE STUDENT, IN RESPONSE, SAID: " PREFER DEATH TO DOING SCREEN IN JAVA" Por RABEI, Jalin 24102022 14h53 Atualizado h uma semana g1 PT-BRORIGINAD NOTICIAS DE TI Q Colegas de Trabalho brigam de faca aps um deles sugerir Java no Front-end O Estudante de Cincia da computao de 21 anos, em resposta disse: "Eu prefiro a morte a fazer Tela em lava" Por RABEI, Jalin 24102022 14h53 Atualizado h uma semana

Don't know if this has been posted yet

Backend Javascript Java Frontend

1 year ago 57.0K views 0 shares

Don't know if this has been posted yet | javascript-memes, java-memes, reddit-memes, language-memes, comment-memes | ProgrammerHumor.io

Content rAskReddit uccaarr123 1h Redditors that speak multiple languages, what languages do you speak in your dreams? Discussion 4 Vote 19 A Share BEST COMMENTS Glitchwinkle 1h JavaScript Reply 17 KDY ISD 16m He said dreams, not nightmares Reply 4 Vote J

Today isn't Jeff's day

Backend php

1 year ago 28.3K views 0 shares

Today isn't Jeff's day | php-memes, data-memes, database-memes, IT-memes, retweet-memes | ProgrammerHumor.io

Content yeff yephph Follow What does this even mean to me v Hello Jeffrey, Unfortunately due to company policy, we are unable to offer positions to people with the name Jeffrey since it will not work with our database schema 1:03 AM - 12 Apr 2020 4,740 Retweets 59,001 Likes