When Mom Reviews Your Code

Code review Family indentation Syntax highlighting Non-technical perspective Software development Code formatting Tech salary

Programming Debugging Testing

8 months ago 178,007 views 0 shares

When Mom Reviews Your Code

code-review-memes, family-memes, indentation-memes, syntax-highlighting-memes, programming-humor-memes | ProgrammerHumor.io

Turns out moms have been doing code reviews all along without the CS degree. "Random English words in fancy colors not aligned to the left" is honestly better feedback than half the PR comments I've received in 15 years. At least she's actually looking at the indentation instead of rubber-stamping with a "LGTM" while secretly watching YouTube in another tab. Give that woman a senior engineer title and a mechanical keyboard – she's already nailed the "questioning why anyone gets paid for this" part of the job.

More Like This

As you see, I'm always typing so I'm efficient.

Programming

3 years ago 55.7K views 0 shares

As you see, I'm always typing so I'm efficient. | ProgrammerHumor.io

Content Company installing system monitoring software to ensure that people work Me who puts weights on keyboard to make it look like I work

Zero Warnings: Corporate Edition

Programming Devops C++ Javascript Python

4 months ago 287.5K views 0 shares

Zero Warnings: Corporate Edition

Compile with -w flag: zero errors, zero warnings. Compile without it: same zero errors but 5678 warnings. Management can't spot the difference because the code still runs. Welcome to production, where we ignore compiler warnings like we ignore our mental health. The real job security is being the only one who knows which warnings actually matter.

Speaking on the topic at hand

Programming

3 years ago 55.9K views 0 shares

Speaking on the topic at hand | ProgrammerHumor.io

Content Some people: OMG ChatGPT can speak like a human person, it's sentient! People who actually learnt Al theory: The ability to speak does not make you intelligent

God comments his code

Programming

2 years ago 58.4K views 0 shares

God comments his code | code-memes, IT-memes, comment-memes | ProgrammerHumor.io

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

I was today years old when I learn that their is Upper and Lower Camel Case.

Programming

2 years ago 73.0K views 0 shares

I was today years old when I learn that their is Upper and Lower Camel Case. | ProgrammerHumor.io

Content The illusion... camel case camelC Came C 1250 ..of free choice.

Bad To Good Within A Second

Programming Git Debugging

9 months ago 195.0K views 0 shares

Bad To Good Within A Second

That moment of sheer horror when you're gleefully criticizing some atrocious code only to have your brain whisper, "Wait... that variable naming convention looks suspiciously familiar..." Suddenly your righteous indignation transforms into existential dread as you realize you're not reviewing someone else's crime against programming—you're staring at your own code from three weeks ago. Nothing humbles a developer faster than becoming the archaeologist of your own terrible decisions.