The Four Horsemen Of Accidental Coding Success

Technical debt Imposter syndrome Software development Edge cases Code quality Programming horror Unexpected success Feature implementation

Programming Debugging Testing Algorithms

2 months ago 82,127 views 0 shares

The Four Horsemen Of Accidental Coding Success

debugging-memes, coding-memes, edge-cases-memes, imposter-syndrome-memes, unexpected-success-memes | ProgrammerHumor.io

The four stages of accidental coding genius! First, pure dread at implementing a complex feature from scratch—standard Tuesday morning existential crisis. Then somehow you bang out the code in a day (fueled by pure panic and energy drinks). But wait—it actually works on the first try? That's suspicious. And finally, the cosmic horror moment when you realize your hastily written code somehow handles edge cases you didn't even think about. Either you're secretly brilliant or you've created an eldritch abomination that will eventually gain sentience and destroy your codebase. Probably both.

More Like This

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you

Programming Backend

3 years ago 15.5K views 0 shares

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you | code-memes, c-memes, IT-memes | ProgrammerHumor.io

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

The quickest way to tell if someone knows what they're doing.

Programming Javascript Java Frontend Backend

3 years ago 33.9K views 0 shares

The quickest way to tell if someone knows what they're doing. | javascript-memes, java-memes, excel-memes, IT-memes, comment-memes | ProgrammerHumor.io

Content rAskReddit uHraVelho 11h What screams "I'm uneducated"? 4 11.3k J 13.5k Share BEST COMMENTS ExcelsiorVFX Now Not knowing the difference between Java and Javascript. Or calling it "C hash tag." Reply 4 0 J

It's Evolving Just Backwards

Programming AI StackOverflow Debugging

1 month ago 95.3K views 0 shares

It's Evolving Just Backwards

Oh. My. GOD. The absolute IRONY of an AI model explaining why AI can't debug properly is just *chef's kiss* PERFECTION! 💅 We've gone from "let me write that complex algorithm for you" to "I have NO IDEA what your code is supposed to do but I'll suggest 47 random fixes anyway!" It's like watching evolution run in reverse - we started with actual debugging and ended with "vibes-based programming." HELP! The four horsemen of AI debugging apocalypse are truly magnificent: too eager but clueless, context-blind, not smart enough, and my personal favorite - "let me try this hacky workaround that will absolutely destroy your codebase!" Brilliant! 🔥

My 85 year old grandfather who didn’t finish high school taught himself programming and Linux and woke up from his 7:30 pm bedtime to provide technical support to his dumb grandchild (me)

Programming Microsoft Windows Linux Backend

1 year ago 36.3K views 0 shares

My 85 year old grandfather who didn’t finish high school taught himself programming and Linux and woke up from his 7:30 pm bedtime to provide technical support to his dumb grandchild (me) | programming-memes, tech-memes, linux-memes, ux-memes, program-memes, ios-memes, windows-memes, rest-memes, ubuntu-memes, bios-memes, IT-memes, ide-memes, comment-memes | ProgrammerHumor.io

Content 8:13 4 rimm. rean i'm seeing on Youture there is a way to erase it from the disk while installing Ubuntu. Is that how you did it? It should offer to intall ubuntu with a "dual boot" (side by side with windows) or to delete windows, but I would recomment that you do a dual boot. I'll check messages in the morning. good nite. Love you. okay, I'II see what I can figure out. Goodnight, love you too! 8:11 PM Just thought of why it's not working for you (I just had to get up and post this). The thumb drive that I gave is a boot-able drive. You'll have to find how to get pc to boot from the us. The setting is in the "Bios." Look up how access the Bios, usually by pressing one of the "F" keys while the pc is booting up (F2 maybe). Once this is done, insert the thumb drive in the us and start, or restart the pc I'll check in morning. Aa ProarammerHumor.ic

Let’s all admit we were like this at some point

Programming

3 years ago 14.5K views 0 shares

Let’s all admit we were like this at some point | programming-memes, coding-memes, code-memes, engineer-memes, program-memes, class-memes, laptop-memes | ProgrammerHumor.io

Content Took one intro programming class starterpack "Dude last night I dreamed in code" "As an engineer Google ph rProgrammerHumor 963,974 members 3,747 online "Here let me hack that for vou" docker Downloads 12 IDES git QUIET BRO CODE Highlights redhat spends 60 on laptop stickers Posts coding screenshots to snapchat

Hip Hip Array! The Amazing Loop

Programming Python

2 months ago 102.4K views 0 shares

Hip Hip Array! The Amazing Loop

Someone just wrote a Python loop that prints "hip hip" and "hooray" alternately and called it "amazing." That's the coding equivalent of discovering fire in 2023. The code increments a counter and checks if it's odd or even - printing "hip hip" for odd numbers and "hooray" for even ones. The real kicker? The variable 'n' isn't even initialized before they start adding to it. Absolute madlad behavior. Seven years of coding experience and I'm still waiting for my "amazing" badge for writing a basic if-else statement.