The Magical Disappearing Coding Skills

Developer anxiety Imposter syndrome Code review Junior developer Senior developer Programming confidence Ever given Suez canal

Programming Debugging Testing

5 months ago 111,095 views 0 shares

The Magical Disappearing Coding Skills

junior-developer-memes, imposter-syndrome-memes, code-review-memes, debugging-memes, workplace-humor-memes | ProgrammerHumor.io

The AUDACITY of this meme! 💀 On the left, we've got the junior dev coding in private - a majestic cruise ship PERFECTLY navigating a narrow canal with millimeter precision. But the RIGHT side? That's the EXACT SAME DEVELOPER the millisecond a senior walks by - suddenly transforming into the infamous Ever Given ship blocking the entire Suez Canal in a catastrophic sideways disaster! Because nothing says "I swear I know what I'm doing" like your code mysteriously breaking the moment someone with experience glances in your direction. It's like your fingers forget how to type and your brain forgets what a function is!

More Like This

Yes, no, or both?

Programming

4 years ago 32.1K views 0 shares

Yes, no, or both? | bot-memes | ProgrammerHumor.io

Content 1 Ferb! This one's looking at both of us at the same time. Quantum Bit Chattering

Sorry if this has been done before

Programming

4 years ago 26.6K views 0 shares

Sorry if this has been done before | ProgrammerHumor.io

Content We are going to freeze to death if we don't do something We only have one option left Oskt, Android studio

Time Traveling Developer Required

Programming AI Python

2 months ago 162.1K views 0 shares

Time Traveling Developer Required

Job requirements: 5+ years experience with LangChain. Google search: LangChain was launched in October 2022. Ah yes, the classic tech recruiter time-travel paradox. "Must have 5+ years experience with technology that's existed for 1.5 years." Next they'll be asking for senior developers who can code in languages that haven't been invented yet. Maybe I should update my resume to include my expertise in quantum programming from the future. The only way to meet these requirements is if you're literally the creator of LangChain or you've mastered the dark arts of resume chronology manipulation.

Spammer as a millionaire 🤭

Programming

3 years ago 28.6K views 0 shares

Spammer as a millionaire 🤭 | coding-memes | ProgrammerHumor.io

Content Me: print("Hello World!) Output: Hello World! WHY I'M SO GOOD AT CODING 10:01

God comments his code

Programming

4 years ago 31.0K views 0 shares

God comments his code | code-memes, IT-memes, comment-memes | ProgrammerHumor.io

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

A programming horror story. At the first day on a new job.

Programming StackOverflow Linux Frontend Backend

4 years ago 67.4K views 0 shares

A programming horror story. At the first day on a new job. | programming-memes, web-memes, stackoverflow-memes, stack-memes, program-memes, rest-memes, http-memes, url-memes, c-memes, cli-memes, overflow-memes | ProgrammerHumor.io

Content EBSENSE. Enterprise Access to this web page is restricted at this time. Reason: The Websense category "Personals and Dating" is filtered. URL: http:stackoverflow.com Options: Click more information to learn more about your access policy. Click Go Back or use the browser's Back button to return to the previous page. Go Back