I Do Not Know What Polymortism Is But I Work At Google

Imposter syndrome Tech interviews computer science Software engineering google Programming basics Fake it till you make it Tech careers Cs fundamentals

Programming Linux Backend

10 months ago 190,196 views 0 shares

I Do Not Know What Polymortism Is But I Work At Google

imposter-syndrome-memes, tech-interviews-memes, computer-science-memes, software-engineering-memes, google-memes | ProgrammerHumor.io

Ah, the classic "fake it till you make it" approach to tech careers. This Google engineer proudly listing all the fundamental CS concepts he doesn't understand is like a surgeon announcing they're not quite sure what blood does. The best part? "Polymortism" isn't even a real term - it's polymorphism, buddy. Nothing says "I deserve my six-figure salary" like not knowing what RAM is while working at one of the world's tech giants. This is why your search results have been acting weird lately.

More Like This

The Invisible Benefits Package

Programming

8 months ago 158.6K views 0 shares

The Invisible Benefits Package

The punchline is literally invisible! That empty pie chart with no legend entries matching the colorful segments is the perfect representation of corporate buyout promises. You're looking at a graph where the colored sections (red, green, blue, yellow) don't correspond to any of the listed benefits (salary, wellness, mental health, confidence). It's like when management promises "synergy" and "exciting opportunities" but delivers... *gestures vaguely at nothing*. The technical term for this is "data visualization gore" and any engineer who's survived an acquisition knows exactly what those missing legend colors actually represent: anxiety, overtime, and updating your resume while pretending to be in a Zoom meeting.

Ah

Programming

1 year ago 55.5K views 0 shares

Ah.. | ProgrammerHumor.io

Content I hate this job WHYIS THIS HAPPENING TO MEEEE and I hate my life nevermind misspelled a variable

The Myth Of Consensual Benchmark

Programming

1 year ago 98.0K views 0 shares

theMythOfConsensualBenchmark | ProgrammerHumor.io

Content I (CONSENT THE MYTH OF "CONSENSUAL" BENCHMARK I CONSENT, I DON'T! 000000 RAM Cache ISN'T THERE SOMEBODY YOU FORGOT TO ASK?

God comments his code

Programming

4 years ago 54.5K views 0 shares

God comments his code | code-memes, IT-memes, comment-memes | ProgrammerHumor.io

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Code never lies...

Programming

4 years ago 46.1K views 0 shares

Code never lies... | code-memes, comment-memes | ProgrammerHumor.io

Content Code never lies, comments sometimes do. - Ron deffries -

Which Team Are You In?

Programming Webdev Networking Javascript Python

7 months ago 328.5K views 1 shares

Which Team Are You In?

The elegant waitstaff vs. the pirates of the digital seas. APIs are the polished professionals of data exchange—neat, documented, and officially sanctioned. Meanwhile, web scrapers are the chaotic renegades who'll pillage your HTML by any means necessary when you refuse to share your data properly. After 15 years in the industry, I've been on both sides. Sure, I'll use your beautiful REST API when available, but catch me at 2 AM cobbling together a janky Python script with BeautifulSoup when your terms of service are too restrictive and my deadline is tomorrow.