First Day Of Week

arrays Indexing Iso Standards Zero-based Calendar

Programming Javascript Debugging

11 months ago 248,336 views 0 shares

First Day Of Week

arrays-memes, indexing-memes, javascript-memes, programming-memes, date-memes | ProgrammerHumor.io

The eternal holy war of array indexing. Programmers are divided into two camps: those who believe weeks should start on Monday (index 0) like ISO standard, and those who think Sunday (index 0) makes sense because... America? Meanwhile, JavaScript's Date object betrays everyone by making Sunday index 0 but Monday index 1. The real crime here isn't the starting day—it's that we're all wasting precious debugging hours arguing about it instead of fixing that memory leak nobody wants to touch.

More Like This

real people know you need to use `psexec -i -s explorer` to gain REAL admin rights

Programming

4 years ago 62.0K views 0 shares

real people know you need to use `psexec -i -s explorer` to gain REAL admin rights | ProgrammerHumor.io

Content 1 would like to delete this file Yep And I own this computer Yep So if I own this computet, I SHOULD be able to delete this file right? That makes sense to me Then delete the file You're not the administrator

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you

Programming Backend

4 years ago 67.6K views 0 shares

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you | code-memes, c-memes, IT-memes | ProgrammerHumor.io

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

Honesty Is The Best Policy

Programming Gamedev Unity Debugging

10 months ago 271.7K views 0 shares

Honesty Is The Best Policy

Game developers cutting corners in the most hilarious way possible! Instead of coding complex water physics and swimming animations, they just slapped a sign saying "PLEASE DO NOT SWIM. There isn't an animation for it." Pure development budget optimization at its finest. The brutal honesty is what kills me - no made-up lore reasons, no invisible walls, just straight-up admitting they didn't have time to implement that feature. Classic gamedev resource allocation decision!

I’ll show myself out, thanks for your time.

Programming

4 years ago 64.3K views 0 shares

I’ll show myself out, thanks for your time. | tables-memes | ProgrammerHumor.io

Content , soft fennec friend softfennec gestures at horses here are the stables gestures at other, flickering, vibrating horses. one horse explodes and here are the unstables ProgrammerHumor.i

Ikea's idea of a Programmer's scheule

Programming Python Java Backend

2 years ago 115.1K views 0 shares

Ikea's idea of a Programmer's scheule | programming-memes, programmer-memes, software-memes, java-memes, python-memes, development-memes, design-memes, program-memes, object-memes, idea-memes, ide-memes | ProgrammerHumor.io

Content OCTOBER SCHEDULE Applied Software Develooment (ASD) 9:00 10:00 11:00 PROGRAMMING Decian Business Anyalvsis AMAINIG 11.00 15.00 Duthen! PROGRAMMING (Python) 16:00 18:00 PROGRAMMING (Java) PLACDAMMING 20:00 21:00 92.00 DISPLAY ONLY STAB F12 ABC NUM SOR. LOCK BACKSPACE END

Another Dumb Bell Curve Meme

Programming

1 year ago 67.0K views 0 shares

anotherDumbBellCurveMeme | ProgrammerHumor.io

Content THISLANGUAGE IS SHIT N0000- DEPENDS 34 34 THIS LANGUAGE IS SHIT 14 14 0.1 2 10 score 55 70 85 100 115 130 2 0.1 145