A Tale Of My Childhood

When you've been coding in dark mode for 8 straight hours and some website designer thinks #FFFFFF is an acceptable background color. My retinas are literally burning through these protective goggles. Pro tip: filter: invert(1) in your browser's dev tools is basically emergency eye surgery for these situations.

Every developer has that moment of galaxy-brain inspiration where we convince ourselves we'll build the next million-dollar SaaS product instead of fixing those 47 bugs in the backlog. That intense concentration while daydreaming about passive income from side projects is practically a developer rite of passage. Meanwhile, our actual codebase sits untouched for weeks because "I'm architecting the solution in my head." The irony? We could've earned more by just putting those hours into our actual job.

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

Content Roses are 0000, violets are 0000 if you can read this, you're a nerd V4

Cloudflare going down has become the developer's equivalent of "my dog ate my homework" - except it's actually true about 40% of the time. The other 60% you're just on Reddit. The beautiful thing about Cloudflare outages is they're the perfect scapegoat. Your code could be burning down faster than a JavaScript framework's relevance, but if Cloudflare has even a hiccup, you've got yourself a get-out-of-jail-free card. Boss walks by? "Can't deploy, Cloudflare's down." Standup meeting? "Blocked by Cloudflare." Missed deadline? You guessed it. The manager's response of "Oh. Carry on." is peak resignation. They've heard this excuse seventeen times this quarter and honestly, they're too tired to verify. When a single CDN provider has enough market share to be a legitimate excuse for global productivity loss, we've really built ourselves into a corner haven't we?

Content BEFORE AND AFTER CODING c javascript java python