My wife and I are both developers...

Content Me Error on line 74 Me Error on ine 82 Me

Content WHO WOULD WIN? a computer program with millions of lines of code one CURLYBOY with no friend solitt Stunt rayfronstring(S( cause unique (arras this.trigger("click e;b c.7 ser logged") vall

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Content 1st Year of C 10th Year of C

Content junior dev: why is it important to include comments in the codebase? me: because they supoorts future reading and modification junior dev: how come your code has none? Listen here, you little shit

Content Computer Problems? NO PROBLEM! Use this manual data entry device. P.E.N.C.IL. Personal Emergency Non-Computerized Information Lifesaver ENTER DELETE