Scientists have discovered hidden annotations in DNA code left by God and it will terrify you

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you | code-memes, c-memes, IT-memes | ProgrammerHumor.io
code-memes, c-memes, IT-memes | ProgrammerHumor.io

Content

Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

More Like This