Real Life One Of Those Days. Yes Those Are My Shoe Prints.

The perfect double entendre doesn't exi-- Turns out HTTPS isn't just for websites anymore! That moment when your romantic partner asks if you have "protection" and you smugly whip out your SSL certificate. Because nothing says "I care about security" like encrypting your, uh, data transfers. The secure connection joke hits different when you've spent 12 hours debugging certificate issues. At least someone's getting a proper handshake tonight!

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

Content christina zhu cszhu if you're not happy single, you won't be happy in a relationship. true happiness comes from closing 100 chrome tabs after solving an obscure programming bug, not from someone else 15:35 21 Feb. 20 Twitter Web App

The gaming industry's evolution is less "technological advancement" and more "descent into madness." Old-school devs were optimization wizards who could fit entire games into kilobytes and make them run on calculators. They'd offer free demos because they actually wanted people to enjoy their creations. Meanwhile, modern "Triple A" studios are out here shipping 50GB games that still need a 50GB day-one patch, requiring NASA-grade hardware just to hit 30fps, and forcing always-online connections for single-player experiences because apparently tracking your every move is an "essential feature." And let's not forget the bizarre workplace environments where employees are apparently... stealing breast milk? I'm not even going to ask what kind of agile methodology that falls under.

Content WHERE'S DADDY? WHERE'S MOMMY? OK NOW, THAT'S ITI YES! WHERE'S THE MEMORY LEAK?

Content namespace HelloWor1dApplication class Program static void Main (string args) TODO: make it print "Hello, World!"