Were you also there?🤔

Nothing says "I trust my users completely" like letting them run raw SQL queries directly against your production database. This code is basically saying "Here's the keys to my database kingdom, please don't DELETE FROM users WHERE 1=1." It's the digital equivalent of leaving your front door wide open with a sign that says "Please don't steal anything." Security teams everywhere just felt a disturbance in the force, as if millions of injection vulnerabilities suddenly cried out in terror.

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Content 499 GB Flash Storage 499 GB Flash Storage Overview Displays Storage Support Service Macintosh 278.43 GB L System System 212.79 GB 9.42 GB Apps Overview Displays Storage Support Service Macintosh HD 278.43 GB available of 499.42 GB System Apps Manage... Available 278.43 GB je...

The classic white plastic chair sits on its throne, crowned in gold, looking down upon the peasantry of fancy gaming chairs, ergonomic office chairs, and artisanal wooden seating. After 15 years in the industry, I can confirm that no matter how much your startup spends on Herman Miller chairs or how many RGB lights your gaming throne has, the most important code is always written in that $5 plastic monstrosity during a 3 AM production emergency. The white plastic chair is the true senior developer of the seating world – cheap, reliable, somehow never breaks, and found in every successful company's "war room." It's not what you want, it's what you deserve.

Content "Security through obscurity is not security" mf when they name their 6 TB porn folder "homeworks"

THE ABSOLUTE AUDACITY of these verification forms showing you the code right above the input boxes! Like, honey, if I can SEE the code, why in the name of all that is holy do I need to TYPE IT?! 🤦‍♀️ It's the digital equivalent of someone handing you a note that says "Please write down what this note says" while you're still holding the original note! Security theater at its most ridiculous! What's next? Asking me to screenshot the password and email it back for "extra verification"?!