Happy Friday

Content Are you going to sleep? Yes lam. Now shut up. How was the first code coded without code to code that code

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It wimm Will Terrify You human7605232288.exe File Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGAIGGTATGGICCITA GAAATCOCCGTTGGOCAGAAATTTATOCGGAG this guy is gonna be so DUMB CCGTTACGCTIGATGATATGGTGGAGTGCCGI GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGICCTAGTGCGTATACAGGTITCCCGCGTA am just put some baboon code in here n see what happens CGAGTGCTGATCOTGGSTAATIGGICGGICAT rspent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICOTGA GGTGGAGTCGAGTGGGTGAGCOTAGGCGTAGC

Santa's face in that last panel says it all. The kid's asking for the one miracle no amount of Christmas magic can deliver: bug-free code that runs perfectly on the first try. I've been coding for 15 years and still check Stack Overflow when my "Hello World" crashes. Some wishes are just too ambitious for this universe's physics engine.

Content You prefer stability and simplicity. Keeping your memory segmented and tidy brings meaning to your life. You're probably also old Java You teach computer science and are focused on "applications" You've never written a single line of production code ano vounave vou were propaov an intern You graduated from unpaid intern to full blown junior programmer You now make android anne You work in game development or at Microsoft. You still say OOP is okay in moderation, and you can stop at anytime. (You are critically addicted to classes) Context free grammars? Graons ano Trees Design Patterns? Monads? eues? What are you talking about bro? I just do Data Science! You find C too simple for your own personal tastes. You'd rather debug templates for the rest of your life. Apparently it pavs well too You are also a masochist. People can't stop talking about you. Probably also identify as LGBTQ or a Furry. php You may have been dropped on vour head as a child You're a hyper nerd who was abused by Java and are currenty in your rebenious onase You also can't stop trying to tell people what a monad is CELILWrO A Greetings stranger, welcome to earth! Here we speak english! Did you know verbs sounds better when they go in front of the subject. Of course you didn't know that, because it isn't true. F I'm not sure what motivated you to use the literal oldestianguage in existence con Maybe you just like working on legacy code that predates the formation of the universe.

Content WHITE IOOP FOR LOOPS DO-WHILE LOOPS

Content Kids in middle school in 2021 learn how to code computer programs. Me in middle school: fb.comDunderMifflinMeme