Czech Facebook Add

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO

Content Computer Facts computerfact "why would you use X" "i do not understand X" "only an idiot would use X" "i am masking my insecurity and ignorance about X with aggression" "you should obviously use Y instead of X" " understand Y. if we shift the conversation to Y i can feel powerful again.' 6:35 AM - 18 May 2019

Content Insanity is doing the same thing over and over and expecting different results." - Einstein My test flaked, let me try it again" - Every Software Developer

The corporate sleight-of-hand that birthed the "full-stack developer" job title in one brutal meme. Instead of hiring separate frontend and backend specialists, some genius in management realized they could just make one person do both jobs while keeping the salary exactly the same. It's the tech industry's equivalent of saying "would you like fries with that?" except the fries are an entire second profession you're now responsible for. And the worst part? We all nodded along and added "full-stack" to our LinkedIn profiles like it was some kind of promotion.

Content Theory: A B Practice: A Machine Learning:

Client: "Our data is very organized and clean!" Developer: *receives a pile of crumbled chocolate cupcakes with random file formats scattered around* The expectation vs. reality gap in data handoffs is the tech world's greatest practical joke. Clients envision their data as this adorable, well-groomed dog cake with perfect frosting roses, while developers get what looks like someone dropped the cake in a parking lot and then tried to fix it with a spatula and blind optimism. And of course, they've sprinkled in some Excel, XML, TXT, and PDF files because why use one consistent format when you can use four incompatible ones? Nothing says "professional data management" like a digital version of a dessert crime scene.