Guess I'll never know now

Content I'm going to work 15min tonight to finish my feature: Great! See you at 9pm for our TV show See you tonight, right?

Turns out Norwegian accidentally became the official language of computer science education. When you translate "datafag" (data subject), you get "computer science." But wait for the plot twist - "slutt datafag" (end data subject) translates to "graduate computer science." So basically, in Norwegian, you don't finish your CS degree, you "slutt" it. No wonder programmers are always talking about their "end conditions" with such enthusiasm.

Content I annefrankenstein666 M 32 points 4 hours ago Cat. permalink source embed save save-res parent report give gold reply hide child comments 1 - IPizzaboxl 1 M H 16 points 8 minutes ago Sy Cat. permalink source embed save save-RES parent report give gold reply hide child comments 4 - comfortador 1 8 points 6 minutes ago Cat. permalink source embed save save-RES parent report give gold reply hide child comments 4 I- redbullcat M H 4 points 3 minutes ago I Cat. permalink source embed save save-RES parent report give gold reply hide child comments 48 - schizotypy 2 points 3 minutes ago S Cat. permalink source embed save save-RES parent report give gold replied - lenswipe 1 point a minute ago Cat. permalink source save save-res parent edit disable inbox replies delete reply ProgrammerHumor.

Content DE WATCHING ME FIGURE OUTTHERES A MISSING SEMI COLON Pathetic.

Content Ash ashcammm guys literally only want one thing and it's fucking disgusting 2017-10-22, 1:56 AM A Solution of the P versus NP Problem Abstract The P versus NP problem is to determine whether every language accepted by some nondeterministic algorithm in polynomial time is also accepted by some (deterministic) algorithm in polynomial time. To define the problem precisely it is necessary to give a formal model of a computer. The standard computer model in computability theory is the Turing machine, introduced by Alan Turing in 1936 37. Although the model was introduced before physical computers were built, it nevertheless continues to be accepted as the proper computer model for the purpose of defining the notion of computable function.

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO