Those damn naming conventions

Content management congratulate me for the huge improvement in runtime me switching to release after accidentally running in debug this whole time

Content Ragecommie 4h Americans: while(true) eatO; Reply 4 210 TatakaRuhito 3h no the code that discribes their food consumption is just: Error Overload 4 57 Ragecommie 3h 4 Awards I believe you mean... SNACK OVERFLOW 4 116 J ProarammerHumor.io

Content 9603060800260008062006200606000000 5djbit cNO nOA340 30IS HOIHM 400002000000090002000000000000000000000000000000000

Content Ajaanz 10 ajaanz If you are a new programmer I just want vou to know me and all of my colleagues with years of experience Google the most basic things 9:07 AM 91822 Twitter for iPhone

Content After all, why not Why wouldn't i use a list I

Content Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human 7605232288 eve Eile Edit Help made he mouth way too big lmao im leavin it in LOL CGTAGCTAGTCATOCAGATOGTATGOTCCTTA GAAATCGCCGTTGGGCAGAAATITATCCGGAG this guy is gonna be so DUMB CCGITACOCTTGATGATATGGTGGAGTGCCGT GASTCCOGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGG11TCCCGCGTA im just put some baboon code in here n see what happens CGAGTOCTGATCGTGGOTAATTGOTCGGICAT spent 7 hours writing this part just to fuck up his toes CCGTITAGCGOTGAGCGAGTTGCGATICGIGA GGTGGAGTOGAGTGGGTGAGCGTAGGCGTAGO